Science Fail: Bad sequencing ≠ Alien DNA

This is a little off topic for the blog theme, but I can’t help a little exercise in pseudoscience deconstruction (especially since it affords me an opportunity to talk a little about cool genetic tools anyone can access and use). This is one of those teachable moments, or rather, a teachable catastrophic and humiliating failure of logic and the application of the scientific method.

Lloyd Pye is an author who believes that humans did not arise via common descent form earlier organisms on earth. Rather, he supports the much more reasonable proposition that early human civilizations were planted on earth by extraterrestrials. To back this up, Mr. Pye thinks he has found the skull of either an alien, or a human-alien hybrid (for now, lets ignore the complete absurdity of hybridizing two organisms with completely unconnected evolutionary pasts).

The 'Starchild' skull: Obviously an alien hybrid and not a deformed human.

The ‘Starchild’ skull was allegedly found in a cave in Mexico 70 years ago. Carbon dating puts it at about 900 years since the individual’s death. DNA testing of the skull by forensic laboratories found an X and Y chromosome, indicating that it belonged to human male from two human parents. In addition, mitochondrial DNA sequencing by another professional laboratory showed that the skull was of Native American ancestry. The skull is likely that of a human child afflicted with hydrocephaly; caused by fluid build up in the cranium that pushes out on the skull and deforms the head as the child develops. For a longer summary of the analyses preformed on the Starchild skull check out this article by Steven Novella.

Since none of the previous scientific analysis indicated that the Starchild was an alien, Lloyd Pye dismisses it out of hand. Recently however, Mr. Pye has announced his own incontrovertible evidence that the Starchid was an alien. Let’s take a look at his evidence, which is apparently so compelling as to justify throwing out the infinitely more reasonable scientific explanations for the Starchild skull.

Are you ready?

This is truly powerful data…

Prepare to have your perceptions of the cosmos and humanity shaken to their very core….

What your’re looking at is an error screen from the BLAST genetic alignment search tool that says:

No significant similarity found. For reasons why, click here

Holy crap!!! I’ve apparently been discovering alien DNA for years! Whenever I get that error, I thought I had simply amplified and sequenced some junk DNA or a aggregation of PCR primers and random genetic material, but no, I (and molecular biologists all around the world) have been discovering countless aliens over the years!

*fiszzzzzit-poof*

Oops! Looks like my sarcasm circuit finally melted down. I’ll guess I’ll explain how blast works and how you can end up looking at the error screen above.

BLAST is an extremely useful tool that allows you to search the entire GenBank database (a NIH administrated depository for genetic sequencing data) based on a query DNA or protein sequence. If you isolate and sequence a new gene you can throw it into BLAST, and BLAST will find, and display in order of similarity, all related sequences from GenBank. In this manner you can confirm the the identity of a gene, what type of protein it codes for, or what sort of animal it comes from.

Here, you can even try it. Suppose your sequencing reactions yield this gene fragment:

CCTGTGGTCCTACACAACATGGTGTTATTTCATGACCTTTGTCTTCATCGTCTACTGCT
ACTGGTTCATCGTAGCCGCTGTCAGAAACCACGAGAAGGCCATGAGGGAGCAGGCTAA
GAAGATGGGCGTCAAGTCCCTCCGAGGCGACGCCGACGCTCAGAAGAAGTCTGCCGA
CTGCAAGCTGGCCAAGATCGCCCTCATCAACGTGTCCCTCTGGTTCATGGCCTGGACA
CCCTACACCATGATCAACATCGCCGGATTGACTAACAAGGAAATCGTCACACCTCTCT
TCTCCATCTGGGGTTCCGTCTTGGCCAAGGCAAACACTGTCT

Copy and paste that into the first ‘Query Sequence’ text box on the BLAST page. Make sure the database is set to ‘nucleotide collection (nr/nt)’ and click the ‘BLAST’ button on the bottom. After a bit of processing it will come back with the closest gene sequences to the one you entered. You should find that the sequence is very similar to an opsin gene from the mantis shrimp, Neogonodactylus oerstedii.

Unfortunately, BLAST doesn’t always generate any matches. That could be because you are searching a subset of the full database, the search alignment stringency parameters are too restrictive, or there is something wrong with the DNA sequence you isolated. This happens all the time and is a common discrepancy in the DNA amplification and sequencing process. Here is a portion of one such sequencing result that I obtained a couple years ago when I was trying to find visual genes in a particular mantis shrimp:

ATGTATACAAATGCTGATGGAGTAATAGGAAAGAAAGAAGAGCTGGGAGACTACATTG
TGGGAA

Search this sequence in BLAST exactly as above and you too can discover alien DNA!

So, this is the new ‘stunning’ evidence that Lloyd Pye has uncovered. An unnamed ‘geneticist’ from an unnamed lab or company has amplified an undisclosed DNA gallimaufry, and thrown it into BLAST; yielding an error message that competent scientists see, and disregard, regularly. From this non-result, he makes a dumfounding leap of un-logic to conclude that the Starchild must have been an alien.

Normally, I would feel bad about picking on such an obvious quack. However, Pye makes a living selling this fraudulent Starchild BS, and he rides it into everyone’s living rooms via the unscrupulous ‘science and learning’ television networks. Pye’s Starchild website boasts:

Sadly, and embarrassingly for these networks, this is one of the few pieces of factual information that Pye presents.

Via the SGU podcast.

About these ads

5 Responses to “Science Fail: Bad sequencing ≠ Alien DNA”


  1. 1 Finn July 31, 2010 at 4:10 pm

    Hello Michael,

    Thank you so much for your efforts. As a fellow scientist and strong proponent of science education in society, I find Pye ‘s Starchild Circus to be disingenuous to the point of fraudulent.

    I am actually finding myself drawn however into what might be the next piece of drama that Pye professes in order to string this along further.

    Anyway, back to the more mundane world of data analysis….

    Thank You!

    • 2 christian December 3, 2012 at 5:10 pm

      fuck you idiots hydrocephaly never creates a distinctly even form such as the one you see and even still the skull would have to have an extreme rapid rate of growth becouse of how thin it is wich is something you of course didn’t even bring up not only that the nose is all wrong even for a diformaty of such standards its designed to create slits on the skin of the face also it’s eyes and neck postions are perfect to all legitamit descriptions of a ”grey” so kiss the tip of my dick you pieceses of shit trying to discreted years of work to force the american government into being open about there direct alien activity we give you proof and you still denie us fuckin white people

  2. 4 Finn December 3, 2012 at 5:50 pm

    Christian, seriously, finish high school.


  1. 1 The Star Child Skull - Page 2 - Alien UFOs Trackback on August 29, 2010 at 6:48 pm

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Connecting to %s




I have moved.
Arthropoda can now be found here.

Michael Bok is a graduate student studying the visual system of mantis shrimp.

Flickr Photos

Hemisquilla californiensis

Snowing in the Grand Canyon

Odontodactylus scyllarus

Tetraconata

Brushing off

Outer Barrier

Outer Barrier

Outer Barrier

Outer Barrier

Outer Barrier

More Photos

Follow

Get every new post delivered to your Inbox.

%d bloggers like this: